Does binding of TF and BS have to work?

No. The following was copied from http://www.cbil.upenn.edu/MTIR/REFs.html#MARKER-9-195 .

A MEF2-binding site at -2642 in chicken MyoD (not located in the minimal promoter) binds MEF2 but is not essential for promoter activity.

* Band shift assays showed that an oligonucleotide containing the MEF2 site at -2642 (cactgcagtaaatatagcactcaaactc) was able to form a complex specific for muscle extracts and showed MEF2-binding. Deletion of the MEF2 site did not affect muscle-specific promoter activation in primary chick myoblast cultures [Dechesne et al. 1994]*.

There are 17 consensus E-boxes located in the chicken MyoD promoter. E-boxes 1,5,7,10, and 13 (numbered 5' to 3') bind myogenic bHLH proteins. These sites, however, are not essential for chicken MyoD promoter activity and are not located in the minimal promoter region.

* Gel mobility shift assays with 24-bp oligonucleotide probes of each of the E-boxes located in the chicken MyoD promoter show that MyoD/E12 and myogenin/E12 bind to E1 (tcccttgcacagctgcagttaaat), E5 (gctgtgaaggcacgtgtgcctgtga), E7 (agaattcaccagctggtca tggct), E9 (gccaatgcacagctgttataccat), E10 (gcctcagaacagctgggagataca), and E13 (gaaatcacacagctgaagtgctgc) -- especially E7, E9, and E10. E9 very efficiently binds the MyoD and myogenin homodimers. MRF4 and myf5 bind to E9 and E10 strongly as heterodimers with E12, and only weakly bind to these sites as homodimers. Deletion analysis showed that the segment between -322 and +177 is fully active in primary myoblast cultures and lacks all E-boxes [Dechesne et al. 1994]*.

Reference:
Dechesne C.A., Wei, Q., Eldridge, J., Gannoun-Zaki, L., Millasseau, P., Bougueleret, L., Caterina, D., and Paterson, B.M. (1994). E-Box- and MEF-2-Independent Muscle-Specific Expression, Positive Autoregulation, and Cross-Activation of the Chicken MyoD (CMD1).Promoter Reveal an Indirect Regulatory Pathway. Mol. Cell. Biol. 14, 5474-86.

A good introduction for transcription mechanism

M. Ptashne. Regulation of transcription: from lambda to eukaryotes. TRENDS in Biochemical Sciences. 2005, 30(6): 275-279

promoter usage affects alternative splicing

PMID: 15901495

Mediator for transcription

The Mediator is a multiprotein transcriptional coactivator that is expressed ubiquitously in eukaryotes from yeast to mammals and is required for induction of RNA polymerase II (pol II) transcription by DNA binding transcription factors. Mediator is required for the regulated transcription of nearly all RNA polymerase II-dependent genes in Saccharomyces cerevisiae, and post-translational modifications of specific Mediator subunits can affect global patterns of gene transcription.

References:
1. Myers, L C; Kornberg, R D, Mediator of transcriptional regulation, Annual Review Of Biochemistry, 2000, 69:729-749

2. PMID: 15780930

3. PMID: 15749018

4. PMID: 15896741

Phosphorylation of transcription factor (TF) may alter the bind site of the TF

Phosphorylation occurs at various locations in Sp1, including the C-terminus, and often results in functional changes to Sp1 such as altered DNA binding and/or promoter activation. [PMID: 15777659, this article discussed many kinds of effects of phosphorylation at Sp1.]

How is the activity of transcription factor regulated?

--------- Affect all target genes ---------------
1. Expression of transcription factor.
2. Intracellular translocation of transcription factor.

--------- May only affect a part of target genes ------------
3. Post-translational modification (e.g., phosphorylation and glycosylation) of transcription factor.
4. Binding with other proteins or small molecule.

--------- Affect a part of target genes-----------------
5. Combinations of transcription factor.
6. Compete binding site with repressors.

acetyl-coenzyme A and transcription regulation

The acetylation and auto-acetylation of general transcription factors has recently been demonstrated, but the functional significance of these modifications is unclear. The presence of acetyl-coenzyme A activates basal transcription, and acetylation of transcription factor IIB (TFIIB) has been shown to activate transcription in several contexts. ... We hypothesize that protein acetylation and Sir2-related deacetylation may be tied to the metabolic regulation of transcription through the availability and action of acetyl-coenzyme A on key transcription factors and transcriptional regulators.[PMID: 15770415]

The type of combination of transcription factors

A set of transcriptional regulators, unique to the thyroid follicular cell type, has been identified as responsible for thyroid specific gene expression; it comprises three transcription factors, named TTF-1, TTF-2, and Pax8, each of which is expressed also in cell types different from the thyroid follicular cells. However, the combination of these factors is unique to the thyroid hormone producing cells, strongly suggesting that they play an important role in differentiation of these cells. [PMID: 11051768]

Pahtway analysis software

Pathway Assist: http://www.ariadnegenomics.com/products/pathway.html
GenMapp: http://www.genmapp.org
LS graph:
Pathway-Expres: http://vortex.cs.wayne.edu/Projects.html
Ingenuity Pathways Knowledge Base: http://www.ingenuity.com