Does binding of TF and BS have to work?
No. The following was copied from http://www.cbil.upenn.edu/MTIR/REFs.html#MARKER-9-195 .
A MEF2-binding site at -2642 in chicken MyoD (not located in the minimal promoter) binds MEF2 but is not essential for promoter activity.
* Band shift assays showed that an oligonucleotide containing the MEF2 site at -2642 (cactgcagtaaatatagcactcaaactc) was able to form a complex specific for muscle extracts and showed MEF2-binding. Deletion of the MEF2 site did not affect muscle-specific promoter activation in primary chick myoblast cultures [Dechesne et al. 1994]*.
There are 17 consensus E-boxes located in the chicken MyoD promoter. E-boxes 1,5,7,10, and 13 (numbered 5' to 3') bind myogenic bHLH proteins. These sites, however, are not essential for chicken MyoD promoter activity and are not located in the minimal promoter region.
* Gel mobility shift assays with 24-bp oligonucleotide probes of each of the E-boxes located in the chicken MyoD promoter show that MyoD/E12 and myogenin/E12 bind to E1 (tcccttgcacagctgcagttaaat), E5 (gctgtgaaggcacgtgtgcctgtga), E7 (agaattcaccagctggtca tggct), E9 (gccaatgcacagctgttataccat), E10 (gcctcagaacagctgggagataca), and E13 (gaaatcacacagctgaagtgctgc) -- especially E7, E9, and E10. E9 very efficiently binds the MyoD and myogenin homodimers. MRF4 and myf5 bind to E9 and E10 strongly as heterodimers with E12, and only weakly bind to these sites as homodimers. Deletion analysis showed that the segment between -322 and +177 is fully active in primary myoblast cultures and lacks all E-boxes [Dechesne et al. 1994]*.
Reference:
Dechesne C.A., Wei, Q., Eldridge, J., Gannoun-Zaki, L., Millasseau, P., Bougueleret, L., Caterina, D., and Paterson, B.M. (1994). E-Box- and MEF-2-Independent Muscle-Specific Expression, Positive Autoregulation, and Cross-Activation of the Chicken MyoD (CMD1).Promoter Reveal an Indirect Regulatory Pathway. Mol. Cell. Biol. 14, 5474-86.
A MEF2-binding site at -2642 in chicken MyoD (not located in the minimal promoter) binds MEF2 but is not essential for promoter activity.
* Band shift assays showed that an oligonucleotide containing the MEF2 site at -2642 (cactgcagtaaatatagcactcaaactc) was able to form a complex specific for muscle extracts and showed MEF2-binding. Deletion of the MEF2 site did not affect muscle-specific promoter activation in primary chick myoblast cultures [Dechesne et al. 1994]*.
There are 17 consensus E-boxes located in the chicken MyoD promoter. E-boxes 1,5,7,10, and 13 (numbered 5' to 3') bind myogenic bHLH proteins. These sites, however, are not essential for chicken MyoD promoter activity and are not located in the minimal promoter region.
* Gel mobility shift assays with 24-bp oligonucleotide probes of each of the E-boxes located in the chicken MyoD promoter show that MyoD/E12 and myogenin/E12 bind to E1 (tcccttgcacagctgcagttaaat), E5 (gctgtgaaggcacgtgtgcctgtga), E7 (agaattcaccagctggtca tggct), E9 (gccaatgcacagctgttataccat), E10 (gcctcagaacagctgggagataca), and E13 (gaaatcacacagctgaagtgctgc) -- especially E7, E9, and E10. E9 very efficiently binds the MyoD and myogenin homodimers. MRF4 and myf5 bind to E9 and E10 strongly as heterodimers with E12, and only weakly bind to these sites as homodimers. Deletion analysis showed that the segment between -322 and +177 is fully active in primary myoblast cultures and lacks all E-boxes [Dechesne et al. 1994]*.
Reference:
Dechesne C.A., Wei, Q., Eldridge, J., Gannoun-Zaki, L., Millasseau, P., Bougueleret, L., Caterina, D., and Paterson, B.M. (1994). E-Box- and MEF-2-Independent Muscle-Specific Expression, Positive Autoregulation, and Cross-Activation of the Chicken MyoD (CMD1).Promoter Reveal an Indirect Regulatory Pathway. Mol. Cell. Biol. 14, 5474-86.
posted by Yiming Zhou at 10:17 PM
0 Comments:
Post a Comment
<< Home